View on GitHub

Computational Techniques for Life Sciences

1) Print the first 2 reads of a fastq file

head -n 8 SRR1570041_1.fastq

2) Print the last read of a fastq file

tail -n 4 SRR1570041_1.fastq

3) What chromosome in ecoli.fasta contains TCCAACTTATTGATAGTGTTTTATGTTCAGATAATGCCGATG?

less ecoli.fasta
/TCCAACTTATTGATAGTGTTTTATGTTCAGATAATGCCGATG
b

>NZ_CP013027.1 Escherichia coli strain 2009C-3133 plasmid unnamed3, complete sequence

Return